SubtiBank SubtiBank
Version comparison:

2017-11-10 15:01:122017-8-11 16:0:3

Biological materials

Mutant

1A918 ( ''scoC''::''erm trpC2 leuC7''), [Pubmed|15126467], available at the [http://bgsc.org/getdetail.php?bgscid=1A918 Bacillus Genetic Stock Center]

BKE09990 (Δ[[gene|scoC]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGTCACCTGCTTCTC, downstream forward: _UP4_GAAGAGCTCGAACCTGTAAA

BKK09990 (Δ[[gene|scoC]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGTCACCTGCTTCTC, downstream forward: _UP4_GAAGAGCTCGAACCTGTAAA

1A918 ( ''scoC''::''erm trpC2 leuC7''), [Pubmed|15126467], available at the [http://bgsc.org/getdetail.php?bgscid=1A918 Bacillus Genetic Stock Center]

BKE09990 ( ''scoC''::''erm trpC2'') is available at the [http://bgsc.org/ Bacillus Genetic Stock Center] [pubmed|28189581]

_ec